Do Design Arguments Commit God Of The Gaps?

They actually don't. As far as the DNA argument goes, the argument is that Scientists know today that languages and codes only come from intelligence and information only comes from an informer. We’ve never seen matter by itself give rise to a code. In fact even Bill Gates has said “DNA is like a computer code except much more complex than anything we’ve ever devised.” He says this because DNA is made up of a 4 character chemical alphabet; A, C, T, & G. A stands for Adenine, C stands for cytosine, T stands for thymine, and G stands for guanine. Instead of the code being “1010100101010101010101000​01111110101010” the code is “ACAACACTGACTGCGGTGGTTGGAC​TCG” this is why many people have equated DNA to a computer code.

Nature can’t produce INFORMATION. It can produce patterns. You know, if your walking down the beach and you see ripples in the sand, what’s your conclusion? Well, that nature (the waves) washed up on shore and created. But if you’re walking down the beach and you see “John Loves Mary” written in the sand with a heart with an arrow through it, you wouldn’t conclude that the waves created that. Why? Because that’s information with content! Nature doesn’t do that! Nature produces patterns! It doesn’t produce information! And whenever we see information, whether it’s in a book, whether it’s in a newspaper, whether it’s in a computer code, we know that intelligence is behind it. This conclusion is based on the scientific principle of uniformitarianism.

As far as the fine tuning argument goes, I think you can avoid being accused of God-Of-The-Gaps when put in the form of William Lane Craig's syllogism.

1: The Fine Tuning Of The Universe is either to physical necessity, chance or design.
2: It is not due to physical necessity or chance.
3: Therefore, it is due to design.

In the case of the fine tuning, you’ve got 3 options. If 2 options are ruled out and the last explanation has the causal power to produce what you’re trying to explain, you go with that explanation. You’re not using an option-3-of-the-gaps argument. For one thing, option 3 is the only explanation left, another thing is that not only is it the only remaining explanation but it has the sufficient causal power to produce what you’re trying to explain. It isn't a God Of The Gaps argument, it's an inference to the best explanation.

when it comes to the fine tuning, you only have 3 options that can explain the fine tuning of the universe. Physical Necessity, Chance, Or Design. Physical Necessity and chance have been ruled out as having explanatory power and design is the only explanation left, so you should go with that one. And not only is it the only remaining explanation, this explanation also has the causal power to explain the fine tuning and whereas the other ones do not. Now if you can think of another alternative to explain the fine tuning, then we’ll add that to the list of possible explanations in premise 1 and then we’ll consider that alternative when we come to premise 2. If this alternative that you can come up with has the causal power to produce the fine tuning, then perhaps we can go with that explanation rather than design. But I can only think of 3 possible explanations to explain the fine tuning of the universe and those 3 possible explanations are physical necessity, chance and design. As I’ve demonstrated above, physical necessity and chance do not have the causal power to produce fine tuning, while an Intelligent Designer DOES have the causal power to explain the fine tuning and that’s why we should go with that explanation.

Whatever it is you’re talking about, if you only have 3 possible explanations, and you rule out option 1 & option 2. You’re not using Option-3-Of-The-Gaps Reasoning, you’re making an inference to the best explanation. As you can see, this isn’t god-of-the-gaps, this is an inference to the best explanation. To further illustrate my point that this is an inference to the best explanation rather than a god-of-the-gaps argument, consider the syllogism below.

1: Either X, Y, or Z.
2: Not X or Y.
3: Therefore, Z.

This how the syllogism for the fine tuning argument is layed out.

Now Imagine the following argument:
1: The Flintstones takes place in either the past, the present or the future.
2: It does not take place in the present or the future.
3: Therefore, it takes place in the past.

Now the first premise seems indisputable. All it does it list the 3 possibilities as to the time period when the cartoon “The Flintstones” is supposed to be taking place. Either it takes place in the past, the present, or the future. Now, the 2nd premise rules out present and future. The conclusion is that it takes place in the past. We can affirm the 2nd premise by doing some thinking. There are dinosaurs around. The theme song describes The Flintstones as “your modern STONEAGE family” (of course MODERN stone age is a contradiction they put in there to make it humorous as the stone age takes place in the ancient past), There’s no technology anywhere to be seen in the show except for animals and dinosaurs that provide the same function as some of the things we have today (i.e the mammoth dish washer). A lot of the animals are animals that have been extinct for millions of years. Therefore, the conclusion follows “3: Therefore, it takes place in the past”

Now would you seriously say that this is Past-Of-The-Gaps reasoning? No, of course not. You made an inference to the best explanation. Given all of the dinosaurs, extinct animals and references to the “Stoneage”, you inferred that the writers of The Flintstones intended for the cartoon to take place in the ancient past, and humorously arranged it to resemble some of the things we have in modern society (e.g feet powered cars and mammoth dishwashers, and tiny pterodactyl powered remote controls).

Maybe Irreducible Complexity is a GOTG argument, but you can't say all of ID's arguments are that way. Moreover, why does it have to be a god of the gaps argument? As far as I can see, you’ve only got 2 options: Either the Darwinian mechanism of natural selection plus random chance….or an Intelligent Designer. If the Darwinian mechanism doesn’t have the causal power to produce a certain biological machine, why not go with the explanation that DOES have the causal power to explain it? Although as it appears to be, Darwinian mechanism just might be able to explain IC systems (at least one of them) so Intelligent Design is not a necessary conclusion for that particular biological system.

Some say "Just wait, maybe a scientific discovery will give a natural explanation". My answer is: Yeah, but we should go with the best explanation UNTIL a better one comes along. Right now Intelligent Design is the best explanation for the fine tuning, DNA, so we go with that until something (if something) better comes along. If we never accepted a scientific conclusion on the basis that something better might come along, scientists would never come to ANY conclusions because there's always the slightest chance that new scientific data might refute the current hypothesis. When Newtonian Physics was accepted I didn't hear anyone go up to Isaac Newton and say "Stop! Stop! Isaac! You can't go through with your hypothesis! Don't you realize that it's possible that future scientific discoveries might prove you wrong? What if some guy named Einstein releases something called General Relativity and the evidence for that hypothesis is better than your hypothesis?" I can imagine Newton responding the same way I did "Yeah, but we should go with the best explanation UNTIL a better one comes along. Right now there's no evidence contradicting my hypothesis and there seems to be a lot of evidence in favor of it. Let's say we go with this explanation [if] and [when] it comes along." In fact, this logic if applied consistently would absolutely stop science in it's tracks completely because there's always the tiniest possibility that we're wrong and that future scientific discoveries might provide us with a better explanation than the one we currently have.

In fact, that actually makes Intelligent Design/Creationism testable and falsifiable. If you could prove that the universe had no beginning (that it existed forever), that there's some law of physics that makes all the universally fine tuned constants take the precise value they do, or that it's possible for information to arise without an intelligent source, then I would imagine we'd have to abandon the creation model and accept the naturalistic hypothesis. The testability and falsifiability of creationism (old earth creationism that is) was actually very well laid out in Hugh Ross' book "More Than A Theory".